Gene	Forward primer (5’-3’)	Reverse primer (5’-3’)
UGT2B15 D85Y	CTGTGGAAAGGTGCTAGT	GAATTTTCAGAAGAGAATCTTCCAGAT
UGT2B17: 1. Primer pairs for deleted region 2. Primer set for flanking sequences of the deletion area.	1.TGAAAATGTTCGATAGATGGACATATAGTA 2.TGCACAGAGTTAAGAAATGGAGAGATGTG	1.GACATCAAATTTTGACTCTTGTAGTTTTC 2.GATCATCCTATATCCTGACAGAATTCTTTTG
UGT2B28	1.ATGACGCATTCACTCTTAAACTC 2.ATAAAGCTGGAAACAGTCATCCT	1.CAATTGTGTAGCCAGGAGTGAAGCA 2. ATTAGGACTAGCAGTAACCATTA.
PCR-RFLP rs361525 (-238G/A):	ATCTGGAGGAAGCGGTAGTG	AGAAGACCCCCCTCGGAACC
T-ARMS-PCR rs1800629 (-308G/A):	FOu: AGGACTCAGCTTTCCGAAGCCCCTCCCA; Fin: GGAGGCAATAGGTTTTGAGGCGCAGGG	ROu: TTCTGTCTCGGTTTCTTCTCCATCGCGG Rin: GTAGGACCCTGGAGGCTGAACCCCGTACT.

Table 1: Genes and the related primers sequences which were used to examine the status of each polymorphism in PCR

Lotus	Model	Geno type	sample size			Prostate cancers vs Controls		BHP vs Controls
			Prostate cancers	BHP	Controls	Odds Ratio	p value	Odds Ratio	p value
UGT2B28	Allele	Ins	207 (86.2%)	203 (84.6%)	203 (84.6%)	1	0.6	1	1
	Allele	Del	33 (13.8%)	37 (15.4%)	37 (15.4%)	0.87 (0.53-1.45)		1 (0.61-1.64)
	Codominant	Ins/Ins	90 (75%)	87 (72.5%)	88 (73.3%)	1	0.77	1	0.91
		Ins/Del	27 (22.5%)	29 (24.2%)	27 (22.5%)	0.98 (0.53-1.8)		1.09 (0.59-1.98)
		Del/Del	3 (2.5%)	4 (3.3%)	5 (4.2%)	0.59 (0.14-2.53)		0.81 (0.21-3.11)
	Dominant	Ins/Ins	90 (75%)	87 (72.5%)	88 (73.3%)	1	0.77	1	0.88
	Dominant	Ins/Del + Del/Del	30 (25%)	33 (27.5%)	32 (26.7%)	0.92 (0.51-1.63)		1.04 (0.59-1.84)
	Recessive	Ins/Ins + Ins/Del	117 (97.5%)	116 (96.7%)	115 (95.8%)	1	0.47	1	0.73
	Recessive	Del/Del	3 (2.5%)	4 (3.3%)	5 (4.2%)	0.59 (0.14-2.53)		0.79 (0.21-3.03)
	Overdominant	Ins/Ins + Del/Del	93 (77.5%)	91 (75.8%)	93 (77.5%)	1	1	1	0.76
	Overdominant	Ins/Del	27 (22.5%)	29 (24.2%)	27 (22.5%)	1 (0.55-1.83)		1.1 (0.6-2)
	Log-Additive					0.88 (0.54-1.44)	0.62	1 (0.62-1.6)	1
UGT2B17	Allele	Ins	165 (68.8%)	143 (59.6%)	181 (75.4%)	1	0.1	1	<0.0001
	Allele	Del	75 (31.2%)	97 (40.4%)	59 (24.6%)	1.39 (0.93-2.08)		2.08 (1.41-3.08)
	Codominant	Ins/Ins	53 (44.2%)	43 (35.8%)	66 (55%)	1	0.22	1	5e-04
		Ins/Del	59 (49.1%)	57 (47.5%)	49 (40.8%)	1.5 (0.89-2.53)		1.79 (1.04-3.07)
		Del/Del	8 (6.7%)	20 (16.7%)	5 (4.2%)	1.99 (0.62-6.45)		6.14 (2.14-17.59)
	Dominant	Ins/Ins	53 (44.2%)	43 (35.8%)	66 (55%)	1	0.09	1	0.002
	Dominant	Ins/Del + Del/Del	67 (55.8%)	77 (64.2%)	54 (45%)	1.55 (0.93-2.57)		2.19 (1.3-3.67)
	Recessive	Ins/Ins + Ins/Del	112 (93.3%)	100 (83.3%)	115 (95.8%)	1	0.39	1	0.001
	Recessive	Del/Del	8 (6.7%)	20 (16.7%)	5 (4.2%)	1.64 (0.52-5.17)		4.6 (1.67-12.71)
	Overdominant	Ins/Ins + Del/Del	61 (50.9%)	63 (52.5%)	71 (59.2%)	1	0.19	1	0.3
	Overdominant	Ins/Del	59 (49.1%)	57 (47.5%)	49 (40.8%)	1.4 (0.84-2.33)		1.31 (0.79-2.18)
	Log-Additive					1.46 (0.95-2.25)	0.08	2.14 (1.42-3.22)	2e-04
UGT2B15	Allele	T	157 (65.4%)	124 (51.7%)	153 (63.8%)	1	0.7	1	0.007
	Allele	G	83 (34.6%)	116 (48.3%)	87 (36.2%)	0.93 (0.64-1.35)		1.64 (1.14-2.37)
	Codominant	TT	47 (39.2%)	30 (25%)	44 (36.7%)	1	0.91	1	0.012
		TG	63 (52.5%)	64 (53.3%)	65 (54.1%)	0.91 (0.53-1.55)		1.44 (0.81-2.57)
		GG	10 (8.3%)	26 (21.7%)	11 (9.2%)	0.85 (0.33-2.2)		3.47 (1.49-8.06)
	Dominant	TT	47 (39.2%)	30 (25%)	44 (36.7%)	1	0.69	1	0.05
	Dominant	TG+GG	73 (60.8%)	90 (75%)	76 (63.3%)	0.9 (0.53-1.52)		1.74 (1-3.03)
	Recessive	TT+TG	110 (91.7%)	94 (78.3%)	109 (90.8%)	1	0.82	1	0.0066
	Recessive	GG	10 (8.3%)	26 (21.7%)	11 (9.2%)	0.9 (0.37-2.21)		2.74 (1.29-5.84)
	Overdominant	TT+GG	57 (47.5%)	56 (46.7%)	55 (45.9%)	1	0.8	1	0.9
	Overdominant	TG	63 (52.5%)	64 (53.3%)	65 (54.1%)	0.94 (0.56-1.55)		0.97 (0.58-1.61)
	Log-Additive					0.92 (0.61-1.38)	0.68	1.76 (1.18-2.62)	0.0045
rs1800629	Allele	G	184 (92%)	204 (92.7%)	206 (93.6%)	1	0.51	1	0.7
	Allele	A	16 (8%)	16 (7.3%)	14 (6.4%)	1.28 (0.61-2.69)		1.15 (0.55-2.43)
	Codominant	GG	84 (84%)	94 (85.5%)	96 (87.3%)	1	0.5	1	0.69
		AG	16 (16%)	16 (14.5%)	14 (12.7%)	1.31 (0.6-2.83)		1.7 (0.54-2.52)
		AA	-	-	-	-		-
	Dominant	GG	-	-	-	-	-	-	-
	Dominant	AG+AA	-	-	-	-		-
	Recessive	GG+AG	-	-	-	-	-	-	-
	Recessive	AA	-	-	-	-		-
	Overdominant	GG+AA	-	-	-	-	-	-	-
	Overdominant	AG	-	-	-	-		-
	Log-Additive					-	-	-	-
rs361525	Allele	G	190 (95%)	213 (96.8%)	215 (97.7%)	1	013	1	0.56
	Allele	A	10 (5%)	7 (3.2%)	5 (2.3%)	2.26 (0.76-6.74)		1.41 (0.44-4.52)
	Codominant	GG	90 (90%)	103 (93.6%)	105 (95.5%)	1	0.12	1	0.55
		AG	10 (10%)	7 (6.4%)	5 (4.5%)	2.33 (0.77-7.08)		1.43 (0.44-4.64)
		AA	-	-	-	-		-
	Dominant	GG	-	-	-	-	-	-	-
	Dominant	AG+AA	-	-	-	-		-
	Recessive	GG+AG	-	-	-	-	-	-	-
	Recessive	AA	-	-	-	-		-
	Overdominant	GG+AA	-	-	-	-	-	-	-
	Overdominant	AG	-	-	-	-		-
	Log-Additive					-	-	-	-

*In this table, the allelic and genotypic frequency comparison of the cancer group to control and the BPH group to controls is given in one table. Yellow columns are the frequency of genotypes and alleles in each study group. Gray shows the comparison between PCa and control, and Orange indicates a comparison of BPH with the control group.
*As is considered, UGT2B17 was associated with the risk of BPH in allelic, Codominant, Recessive, and Log-Additive modes of inheritances. The G allele was more prevalent among BPH cases compared with controls (OR (95% CI) =1.64 (1.14-2.37), P value = <0.0001. For example, in the codominant model, individuals carrying the GG genotype had a significantly higher risk of BPH in comparison with those who carry the TT genotype (GG versus TT: OR (95% CI) = 3.47 (1.49-8.06), P value 0.012). Also, UGT2B15 was associated with the risk of BPH in allelic, Codominant, Recessive, and Log-Additive modes of inheritances (P value= 0.007).
*rs1800629 and rs361525 show no significant association with PCa or BPH in any of the inheritance models. Dash lines: no genotype or allele.
Table 3: Results of correlation analysis between UGT2B28, UGT2B17, UGT2B15, rs1800629 and rs361525 polymorphisms and risk of BPH and prostate cancer

rs1800629	rs361525	Frequency in Prostate cancer	Frequency in BPH	Frequency in control	Prostate cancer vs Controls		BPH vs Controls		Prostate cancer vs BPH
rs1800629	rs361525	Frequency in Prostate cancer	Frequency in BPH	Frequency in control	OR (95%CI)	P value	OR (95%CI)	P value	OR (95%CI)	P value
G	G	0.8763	0.8955	0.9136	1.00	-	1	-	1	-
A	G	0.0737	0.0727	0.0636	1.24 (0.56 – 2.76)	0.59	1.2 (0.55-2.6)	0.65	1.05 (0.48-2.29)	0.9
G	A	0.0437	0.0318	0.0227	2.08 (0.66 – 6.57)	0.22	1.46 (0.45-4.79)	0.53	1.44 (0.5-4.14)	0.5

UGT2B28	UGT2B17	UGT2B15	Frequency in Prostate cancer	Frequency in BPH	Frequency in control	Prostate cancer vs Controls		BPH vs Controls		Prostate cancer vs BPH
UGT2B28	UGT2B17	UGT2B15	Frequency in Prostate cancer	Frequency in BPH	Frequency in control	OR (95%CI)	P value	OR (95%CI)	P value	OR (95%CI)	P value
Ins	Ins	T	0.4778	0.4133	0.4897	1.00	-	1	-	1	-
Ins	Del	G	0.2515	0.296	0.1827	1.41 (0.82-2.44)	0.22	2.02 (1.18-3.47)	0.011	0.72 (0.44-1.19)	0.2
Ins	Ins	G	0.0863	0.1012	0.1475	0.66 (0.35 – 1.24)	0.2	0.94 (0.5-1.76)	0.84	0.75 (0.38-1.49)	0.41
Del	Ins	T	0.1154	0.0654	0.117	1.07 (0.59 – 1.95)	0.83	0.68 (0.3-1.56)	0.37	1.85 (0.79-4.31)	0.16
Ins	Del	T	0.0469	0.0353	0.026	2.02 (0.62 – 6.56)	0.24	1.48 (0.41-5.29)	0.55	1.25 (0.4-3.86)	0.7
Del	Del	G	*0	0.0701	0.0323	*-	-	2.97 (0.94-9.37)	0.065	-	-

Given that the p value is not less than 0.05 in any of the cases, so in terms of frequency, each haplotype of any of the five polymorphisms, shows a similar distribution in cancer and BPH groups compared to the control group. If a particular haplotype, for example, was seen with higher or lower frequently in the BHP samples, it would be possible to discuss it by presenting p value and odds ratio, but none of them showed a significant difference.
*0: This haplotype (Del Del G) was not present in PCa individuals.
*dash: When there is no haplotype, it is not possible to compare this group with the reference group
Table 5: Haplotype frequencies were calculated using the SNP Stats (https://www.snpstats.net/start.htm) based on the expectation maximization algorithm

	*G Score
	≤ 6	> 6	P value
UGT2B28			0.54
Ins/Ins	49 (54.4%)	41 (45.6%)
Ins/Del	12 (44.4%)	15 (55.6%)
Del/Del	1 (33.3%)	2 (66.7%)
UGT2B17			0.26
Ins/Ins	23 (43.4%)	30 (56.6%)
Ins/Del	34 (57.6%)	25 (42.4%)
Del/Del	5 (62.5%)	3 (37.5%)
UGT2B15			0.01
TT	19 (40.4%)	28 (59.6%)
TG	34 (54%)	29 (46%)
GG	9 (90%)	1 (10%)
rs1800629			0. 27
GG	40 (47.6%)	44 (52.4%)
AG	10 (62.5%)	6 (37.5%)
rs361525			0.5
GG	46 (51.1%)	44 (48.9%)
AG	4(40%)	6 (60%)

Tables at a glance

Figures at a glance

	UGT2B28 (frequency)	UGT2B17 (frequency)	UGT2B15 (frequency)	rs1800629 (frequency)	rs361525 (frequency)
Control	0.15	0.33	0.077	1	1
BPH	0.48	0.85	0.58	1	1
Prostate cancer	0.46	0.14	0.11	1	1