Figure 1: Fo primer: 1121-1142 bp in VP2 gene (Red colour), Fi primer 1257-1276 bp in VP2 (underlined); 1276-1278 bp in VP2 gene is the mutated amino acid asparagine (Green colour)
Primers |
Sequence (5’ to 3’) |
Position in VP2 |
Length (bp) |
|
Fo |
GTGATCCAAGATATGCATTTGG |
1121- 1142 |
22 |
|
Ro |
TAATTTTCTAGGTGCTAGTTGAGA |
1749- 1726 |
24 |
|
Fi |
CTTTAACCTTCCTGTAACAA |
1257-1276 |
20 |
|
Ri |
GTTGGTAGCAATACATTATCATC |
1298- 1278 |
23 |
|
Primer combinations |
Product size (bp) |
CPV Variants Detection |
||
Fo + Ro (Set 1) |
629 |
CPV |
||
Fi + Ro (Set 2) |
493 |
CPV 2a |
||
Fo + Ri (Set 3) |
178 |
CPV 2b |
Table 1: Primers for Tetra Arms PCR along with their combination
Figure 1: Fo primer: 1121-1142 bp in VP2 gene (Red colour), Fi primer 1257-1276 bp in VP2 (underlined); 1276-1278 bp in VP2 gene is the mutated amino acid asparagine (Green colour)
Figure 2: Fo, Fi and Ri primer sequence in multiple alignment
Figure 3: Ro primer sequence in multiple alignment
Figure 4: Conventional PCR for identification of CPV
Figure 5: Typing of CPV in TETRA ARMS PCR
Tables at a glance
Figures at a glance